Biogenomika Perzije

Izvor: Wikinfo na Hrvatskom jeziku
Skoči na: orijentacija, traži
HrvatGrb.png

Biogenomika Perzije (Y-kromosomi od Kurdistana do Pakistana): Prikazan je genski spektar glavnih haplogrupa na Y-kromosomu u povijesnom području Perzije, tj. na jugu do Perzijskog zaljeva i Arapskog mora, na zapadu do rijeke Eufrat i na istoku do rijeke Ind, a na sjeveru do rijeke Syr-Daria, Arala i Kaspija i južnog Zakavkazja. U tekstu se najprije daje današnji raspored glavnih haplogrupa i potom se preko poznatih povijesnih migracija nastoji bar približno izvesti raspored Y-haplogrupa u doba klasične Perzije, te moguće implikacije toga na ranu etnogenezu Hrvata.

Abstract

Persia's biogenomics (Y-chromosomes from Kordestan to Pakistan): A comparative genetical survey of the main haplogroups on Y-chromosome in recent Iran and surrounding countries of south-western Asia is given. It starts by the actual distribution of Iranian haplogroups, and then in correlation with medieval and recent migrations their probable distribution in the classical Persia is offered.

Važnost Perzije za Hrvate

Biogenetika Perzije je poredbeno od prvorazredne važnosti za Hrvate, jer jedna od glavnih naših teorija etnogeneze smatra da odatle bar dijelom potječu hrvatski pretci. Čak i ostali npr. jugoslavisti koji to (ideološki) ne prihvaćaju, ipak priznaju kako je narodno ime (etnonim) Hrvata neslavenski i vjerojatno iranskog iskona. Stoga je kao naša minimalna veza s Iranom barem ranohrvatska plemenska elita koja je manjeviše sigurno iz prednje Azije prenesla do nas taj hrvatski etnonim. Nova poredbena genetika materinskih mitohondrija medjutim pokazuje kako su oni kod Hrvata pretežno neslavenski preko 80%, a u Dalmaciji i Hercegovini većinom iz jugozapadne Azije što fizički pokazuje da je veliki dio običnog naroda i žena, a ne samo elita ovamo doselio iz šireg prostora klasične Perzije: vidi još pobliže Mitohondri neslavenskih Hrvata.

Y-grupe oko Irana danas

Osim za Židove i susjedne semitske narode na Levantu (istočno Sredozemlje), za većinu inih izvaneuropskih etnogrupa iz jugozapadne i srednje Azije ranije do god. 2001. uglavnom nije bilo suvislih naznaka o njihovu biogenetskom spektru. Kroz zadnjih desetak godina je dosad već objavljeno desetak izvješća o genetici samog Irana (Nasidze 2002, 2006, 2008, 2009, Quintana-Murci i sur. 2006, Regueiro i sur. 2006). Takodjer su dosad kroz dvadesetak radova manjeviše genetski obradjeni i susjedni narodi na bivšem ozemlju Perzijskog carstva (Nasidze i surad. 1990-91, 1995, 2004, 2005, Wells i sur. 2001, Weale i sur. 2001, Mohyuddin i sur. 2001, Qamar i sur. 2002, Al-Zahery i sur. 2003, Roewer i sur. 2009, Cilli i sur. 2010, itd.). Donedavna je genetski ostao neistražen samo Afganistan, o komu je tek u zadnjih par godina konačno izašlo nekoliko genetičkih izvješća (Sabitov 2010, Cristofari i sur. 2011, Lacau i sur. 2011), pa su tako Iran i susjedne zemlje u okružju dosad već za opće poredbe manjeviše zadovoljavajuće genetički poznati. Osim za semitski Levant, zamalo svi naši genetičari (osim D. Primorca) te nove genetske prikaze iz prednje Azije uporno preskaču, zaobilaze i prešućuju, pa ih uopće ne usporedjuju s nama iz taktičko-ideoloških razloga da im ne poremete zadane iliro-slavenske dogme: vidi pobliže Orwelska pseudo-genetika. Zato ovdje na sažet i sustavan način dajemo biogenetske poredbe Hrvata s dosad proučenim narodima iz prednje Azije, uz potrebne komentare o paralelnim kulturno-povijesnim vezama.

Prednjoazijski J2/Eu9

Prednjoazijska haplogrupa J2/Eu9 (ili biokemijska formula: J-12f2, M172 - T>G197 ttgaagttacttttataatctaatgctt / ataatttattactttacagtcacagtgg) prevladava u jugozapadnoj Aziji, manje u Kurdistanu i Gruziji, a najviše od Sirije i Irana do Arabije. Pripadni narodi govore raznim jezicima tj. dijelom semitski i takodjer indoiranski: Iranci, Kurdi, Oseti, Tadjiki, Armenci itd. U Hrvatskoj je J2/Eu9 zastupljen oko 5,2%, a najviše u Kvarneru do 11%. Nalazi se kao manjinski genotip uglavnom ondje, gdje kod nas inače dominira dinarski tip I2/Eu7 i razmjerno najviše na otočnom području bodulskog cakavizma. Antropološki odraz tog genotipa su najviše crne oči i tamno-crnkasta kosa, ali je nasuprot tomu većinom svjetlija bljedunjava koža (izim ljeti zbog sunca), a nos je većinom uži i kljukast ("bizantinski"). U današnjem Iranu je to većinom dominantni haplotip koji sadrži po 33-35% tj. oko 1/3 muških Iranaca, a takodjer manjeviše dominira i u susjednom Kurdistanu.

Semito-levantski G2/Eu11

Semito-levantska grupa G2/Eu11 (M-201: G>T136 tatgcatttgttgagtatatgtc / gttctgaatgaaagttcaaacg): Ova haplogrupa je osobito značajna za Semite na Levantu, u Arabiji i sjevernoj Africi, pa se nalazi kod većine Židova, Arapa, Beduina itd. S manjim udjelom (10-15%) dolazi npr. u Španjolskoj, južnoj Italiji i Grčkoj, a najmanje u srednjoj i istočnoj Europi. U Hrvatskoj se prosječno nalazi 1-2%, a najviše na južnim otocima: Brač 6% i Korčula 10%, dok sjevernije izostaje. Antropološki odraz toga genotipa je općenito tamna pigmentacija, crne oči, garavo-crna i rudlavo-kovrčasta kosa i brada. U Iranu je to treći haplotip koji obuhvaća 12% do 15% ili 1/6 do 1/7 muškog pučanstva, čiji su nosioci većinom potomci islamskih Arapa što su u srednjem vijeku osvojili klasičnu Perziju.

Sjevernoafrički E3/Eu4

Hamito-magrebska grupa E3b/Eu4 (M35 - G>C168 taagcctaaagaagcagtcagag / agagggagcaaatgaggaca) nalazi se pretežno kod hamitskih naroda uz južne obale Sredozemlja i u sjevernoj Africi, npr. Egipćani, Abesinci, Berberi itd. U južnoj Europi je to najstariji i rijedak genotip, podrijetlom od prapovijesnih doseljenika do neolita, koji su sudjelovali u ranom razvitku poljodjelstva i prvih keramičkih kultura, a u dolini Nila je taj genotip bio glavni većinski nositelj visoke pracivilizacije faraonskog Egipta. U Hrvatskoj Eu4 obuhvaća oko 5% pučanstva uglavnom medju čakavcima, a razmjerno najviše na otoku Krku gdje dostiže blizu 7% i tu su njegovi nosioci vjerojatni potomci halkolitnoga predliburnijskog plemena Hythmethi koji su preplovili Mediteran zbog presušivanja Sahare, pa na Kvarneru osnovali prva neolitska sela i uveli rano poljodjelstvo. Antropološki odraz toga genotipa je razmjerno sitniji rast, uže trokutno lice ("mišoliko"), a kosa je većinom valovito-kovrčasta i tamno-crnkasta. U Iranu je ovo manja južna haplogrupa, koja u sjevernom kopnenom dijelu uglavnom izostaje, dok na južnom primorju dostiže blizu 7% muških primoraca.

Eurazijski tip R1a/Eu19

Eurazijska haplogrupa: R1a/Eu19 (M17: delG68 ctggtcataacactggaaatc / tgaacctacaaatgtgaaactc), I.Jurić: "slavenski" haplotip. Taj tip dominira u Indiji i istočnoj Europi, zapadnom Sibiru i srednjoj Aziji do Pakistana. Naziv "slavenski" je preuzak i neprikladan, jer je takodjer obilan i kod mnogih naroda prednje i južne Azije osobito Tadžikistan, Pakistan i Kašmir, što uglavnom odgovara istočnoj indoeuropskoj grupi satem-jezika. Protivno današnjemu južnoslavenskom jeziku, kod prisilnih "slavenskih" Hrvata to je izrazito manjinski tip, u prosjeku tek 23% - 38% ili samo 1/4 do 1/3 pučanstva, tj. najviše takodjer spram sjevera i sjeverozapada, a najmanje na dalmatinskim otocima: vidi još pobliže Eurazijski genom R1a/Eu19. U Iranu je to druga glavna haplogrupa i najvažnija od europskih, koja je danas manjeviše raširena cijelim Iranom prosječno sa 25-27%, kao i u okolnim zemljama bivše klasične Perzije. Opća je raširenost te haplogrupe u Aziji: Tadjiki 68%, Kirgizi 65%, Khojani 64%, Kašmirci 60%, Afganci 51%, Sindhi 49%, Kalaši/Ind 45%, Indobalti 45%, Pakistan (prosjek) 42%, Bartangi 40%, južna Indija (Dekan) 39%, Tatari 32%, Uzbeki 31%, Makrani 30%, Baludjistan 30%, Buruši/Ind 30%, Ujguri 22%, Tuvini/Sibir 14%, Kurdi 12%, Turci (prosjek) 12%, Gruzijci 11%, Azeri 10%, Aškenazi 10% - (ostali Azijci ispod 10%).

Eurozapadni R1b/Eu18

Eurozapadna haplogrupa: R1b/Eu18 (M173: A>C191 aagaaatgttgaacgaaagttgat / aggtgtatctggcatccgtta), I.Jurić: "baskijski" haplotip. To je glavni zapadnoeuropski haplotip paleolitskog iskona koji dominira u većini naroda od Španjolske i Italije do Škotske i Baltika, pa većinom odgovara zapadnoj grupi centum-jezika. Najviše ga podjednako imaju Irci 93%, pa Baski 89% i Welšani 82%, dakle je naš naziv "baskijski" neopravdan i preuzak jer je bolje "irski". U Hrvatskoj taj zapadni tip obuhvaća tek 10% - 16% pučanstva i to razmjerno najviše na zapadu u Hrvatskom Zagorju, Gorskom Kotaru, Istri i medju otocima najviše na Krku (16 %), a najmanje na Hvaru (1 %), što je logično obzirom na blizinu zapadne Europe. Genetska raširenost Eu18 se uglavnom poklapa s antičkim širenjem Kelta kroz Europu i kod nas: vidi još pobliže Eurozapadni genom R1b/Eu18. U današnjemu užem Iranu je ta zapadna grupa rijetka, ali se s većim udjelom nalazi u širem okružju klasične Perzije: osobito Turkmeni i Oseti 2/5 pučanstva, Armenci i Kurdi 1/3, mazdaistički Parsi (Pakistan) 1/5 itd. Opća raširenost R1b u Aziji: Hazari 60%, Baškiri 47%, Turkmeni 45%, Oseti 40%, Armenci 38%, Sogdijci 32%, Buruši/Ind 30%, Sefardi 30%, Kurdi 29%, Makrani 29%, Dungani 28%, Kašmirci 25%, Parsi 22%, Ujguri 20%, Gruzini 19%, Sindhi 18%, Lezgini 17%, Sirijci 15%, Azeri 14%, Fergana 13%, Horezmi 12%, Pathani/Ind 11%, Udmurti/Sibir 12%, Aškenazi 11% - (ostali Azijci ispod 10%).

Dinarokavkaski İ2/Eu7

Dinarokavkaska haplogrupa: İ2/Eu7 (biokemijska formula: M170 - A>C327 tgcttcacacaaatgcgttt / ccaattactttcaacatttaagacc), I.Jurić: "hrvatski" haplotip. To je najčešća i dominantna haplogrupa u Hrvatskoj i BiH, a inače se nalazi uglavnom na Kavkazu i Balkanu, pa manje u srednjoj Europi itd. (Rootsi i sur. 2004), a najviše u Hrvatskoj 45% - 49% i u BiH 48 – 73% gdje ima najveću poznatu koncentaciju u Hercegovini i na dalmatinskim otocima (Marjanović i sur. 2006),- ali podjednako (33-82%) i na Kavkazu narodi Swaneti, Dargyni itd. (Nasidze i sur. 2003-2005). Zato je naš naziv "hrvatski" haplotip preuzak i nerealan, jer bi se po sličnoj logici s istim pravom mogao zvati i "swano-dargynski". Kod nas ga ima najviše u Hercegovini, Lici, Dalmaciji i istočnoj Slavoniji, a najmanje u Istri, Gorskom Kotaru i Medjimorju, pa tom genomu uglavnom pripada dinarski tip pučanstva Bosne, te srednje i južne Hrvatske. Znakovito je da se Eu7 (M-170) pojavljuje i dalje na istoku izdvojeno u Moldaviji (32 %) i još izvan Europe najviše na Kavkazu do 82%, pa u kaspijskom Dagestanu i središnjoj Aziji gdje niz tamošnjih etnogrupa sadrže po 10-25%, što je možda u vezi s dalekim praiskonom ranih pradinaraca. Vidi još pobliže o toj haplogrupi: Dinarokavkaski genom İ2/Eu7.

Ova je naša haplogrupa manjeviše nazočna i u prednjoj Aziji, na istoku bar s nižim udjelom sve do Fergane i Pakistana. U užem Iranu se najviše nalazi u prijestolnici Teheran (1/3 gradjana), pa u Isfahanu 1/7, dok za ina manja naselja zasad još nema detalja. Takodjer je zastupljena i u okružju klasične Perzije, npr. na Kavkazu Swaneti 4/5 naroda, Dargyni 3/5, pa Adygeji, Abhazi, Oseti, Gagauzi i sjeverni Kurdi (Delamiti) 1/3, ini Kurdi (Kurmandji) 1/6, Pakistan do 1/7, a jedino izostaje u jugoistočnom Iranu i Afganistanu. Opća je raširenost I/Eu7 u Aziji: najviše kavkaski Swaneti 82% i Dargyni 58%, Abhazi 34%, Teheran 33%, Delamiti (Zazaki) 33%, Oseti 32%, Gagauzi 31%, Andi 27%, Adygejci 25%, Mordvini 19%, Isfahan 17%, Tatari 16%, Taškent 12%, Čuvaši 11 %, Buhara 10%, ini Kurdi 9%, Pakistan 8%, Uzbeki 7%, Udmurti 7%, Karačaji 7%, Nenezi 6%, Fergana 5%, Azeri 5%, Lezgini 5%, Nogajci 5%, Sirijci 5%, Libanon 5%, Armenci 4%, Kazbeki 4%, Marijci 4%, pravi Turci (bez Kurda) 4% - (ini Azijati su ispod 4%).

Ine manje haplogrupe

Izim tih glavnih iranskih Y-haplogrupa koje su manjeviše zastupljene i u Hrvatskoj, u Iranu je danas nazočno još nekoliko manjih jugoistočnih haplogrupa koje su rjedje u Europi i kod nas većinom izostaju:

  • Haplogrupa N je sjeverna grupa najraširenija u Sibiru i kod uralo-finskih naroda, npr. Finci i Balti. Kod nas uglavnom izostaje, a u Iranu se nalazi samo na sjevernom rubu do 6%.
  • Haplogrupa Q ili "indianska" grupa je s nižim udjelima kozmopolitska, ali je dominantna kod američkih Indianaca. Kod nas uglavnom izostaje, a u Iranu je nazočna samo u sjevernom dijelu do 9%.
  • Haplogrupa K je rjedja prastara grupa u Indiji i jugoistočnoj Aziji do Oceanije, a na perzijskom prostoru se rjedje nalazi u Pakistanu i južnom Iranu do 3%.
  • Haplogrupa L je mladja izvedena iz K, a najviše je ima u južnoj i srednjoj Aziji i na zapadu do Kurdistana, a u Europi je rijetka npr. južni Tirol. Nazočna je samo u južnom Iranu do 6% i u južnom Pakistanu do 23%, te obilno dalje u Indiji. Inače je antropološki značajna za negroidne Dravide i pripadne dravidske jezike.

Pragenomi klasične Perzije

Izravni podatci o genetici starih Perzijanaca su zasad uglavnom nedostupni, iako bi se ubuduće mogli približno dobiti analizama iz tadanjih kostura o kojima u dostupnoj literaturi nema podataka. Ipak se bar neke grube približne naznake mogu donekle izvesti iz kasnijih srednjovjekih selidbi do danas i iz pripadnih haplotipa sadanjeg pučanstva, što se niže daje po bivšim pokrajinama širega Perzijskog carstva.

Središte stare Perzije

Danas u središtu Irana uglavnom dominiraju 2 haplogrupe: prednjoazijska J2/Eu9 i istočnoeuropska R1a/Eu19. Za prvotno antičko stanje klasične pokrajine Parsa bi bile najvrijednije genske analize autohtonih perzijskih mazdaista u pustinjskim naseljima središnjeg Irana - osobito nutarnjih gradova Yazd i Kerman, koje dosad još nisu poznate. Ipak u tom pogledu dijelom mogu poslužiti genetski nalazi za iseljene mazdaističke Parse, koji su pri srednjovjekoj provali Arapa prebjegli u sadanji južni Pakistan i zapadnu Indiju. Ovi su genskim spektrom sličniji Armencima, Turkmenima i Sogdima, pa se uz ino kod njih posebno ističe viši udjel zapadne haplogrupe R1b/Eu18 preko 1/5 populacije ili 22%, koja je rijetka u današnjem Iranu. Takodjer klasični perzijski reljefi i kipovi, osobito iz doba Sassanida očito prikazuju većinom takve zapadnjačke likove. Sve to znači kako je u klasičnoj sasanidskoj Perziji jamačno vladao elitni sloj eurozapadnog tipa, koji je arapska invazija većinom uništila, a preživjeli ostatak se kao Parsi povukao u Indiju.

Sjeverozapad Perzije

Na brdskom sjeverozapadu u Zakavkazju (Nasidze i sur. 1990-91, 1995, 2004, 2005, 2008, Weale i sur. 2001), danas je šareni mozaik raznih naroda, jezika i haplotipova, koji je u donekle sličnom izgledu uz lokalne promjene omjera manjeviše postojao vjerojatno i u staroj Perziji, tj. uz razne ine haplogrupe i naša dinarska grupa I/Eu7 (danas od 31-82%).

Jugozapad: Kurdistan

Na jugozapadu u Kurdistanu je vjerojatno stanje manje promijenjeno, jer su tu još u antičko doba po zapisima Ksenofonta nastavali Kurdi (Kardouchoi), čiji se genski spektar vjerojatno nije bitno izmijenio. To bi značilo da se uz dominanthe haplogrupe G2/Eu9 i R1a/Eu19, tu manjeviše nalazio i naš dinarski tip I2/Eu7, koji danas obuhvaća od 16-33% zapadnih i sjeverozapadnih Kurda.

Primorski jug Perzije

Izim središnjeg Irana, južno primorje se populacijski i genski kroz povijest vjerojatno najviše izmjenilo. Od prapovijesnog doba su tu dominirali negroidni Dravidi uključivo i rane Elamite, koje je vjerojatno najviše uništila srednjovjeka provala islamskih Arapa, što i danas dominiraju tu na jugu, gdje je preostalo tek do 6% negroidnog haplotipa.

Istok Irana: Harauvatya

Naša klasična Harauvatiya (starije Harahvaiti) je u doba Ahemenida obuhvaćala srednji i južni Afganistan sa središtem u Kandaharu, kao i susjedni sjeverozapadni Pakistan tzv. pojas "Tribal Area". Krajem antike i u srednjem vijeku su tuda protutnjale uzastopne provale i migracije indoeuropskih Kušana, pa nomadskih Mongola i inih mongoloida, tako da je stari raspored etnogrupa dijelom izmijenjen. Sve donedavna je genetika Afganaca (Paštuna) bila skoro nepoznata i tek zadnjih par godina tu postoje sustavne analize Y-haplotipa (Sabitov 2010, Cristofaro i sur. 2011, Lacau i sur. 2011), a za poredbu su važni i raniji nalazi iz susjednog Pakistana (Mohyuddin i surad. 2001, Qamar i sur. 2002). Po tim analizama iz sjevernog i srednjeg Afganistana oko gorja Hindukuš dominira istočnoeuropska haplogrupa R1a/Eu19 čak sa 51% ili pola svih Paštuna, a ostalo su ine manje grupe (bez našeg I/Eu7). U susjednom Pakistanu je isto relativna dominacija R1a u 2/5 pučanstva ili 42%, dok se uz ine manje grupe na sjeverozapadu (Tribal Area) pridolazi i 7% - 16% naše grupe I/Eu7, što je njeno krajnje jugoistočno područje. Za bolji genski uvid stare Harauvatiye bi bio osobito važan genetski spektar južnog Afganistana kod Kandahara (središte Harauvatiye), odakle dosad još nema podataka.

Sjeveroistok: Sogdia

U antičko doba do srednjeg vijeka je na sjeveroistoku klasične Perzije bilo vazalno kraljevstvo Sogdija (perzijska Sugda), čije je indoiransko pučanstvo većinom uništila srednjovjeka invazija islamskih Arapa. Manji dio preživjelog pučanstva se kao etnogrupa Yaghnobi povukao u visoko gorje Tadjikistana, gdje su ih ekonomski dotukli komunistički Sovjeti, pa ih je dosad preživilo tek par tisuća od nekoć velikoga sogdijskog naroda. Njihova genetika je u širjem okružju dosta specifična, jer slično kao Parsi i Armenci, tako i ovi posljednji reliktni Sogdi imaju povišeni udjel zapadnog haplotipa R1b/Eu18 oko 1/3 pučanstva ili 32% (Cilli i surad. 2010). Oko njih danas obilno dominira istočnoeuropska haplogrupa R1a/Eu19: Tadjiki 68% i Kirgizi 65%, što je vjerojatno naknadna dominacija kasnije doseljenog pučanstva, nakon srednjovjekog genocida prvotnih zapadnjačkih Sogda.

Sjever Irana: Parthia

Na sjeveru klasične Perzije u pokrajini Parthia izmedju Arala i Kaspija, tj. danas Turkmenistan i Uzbekistan sada dominiraju razne azijatske haplogrupe kao J/Eu9, O/Eu16, itd. U doba klasične Perzije je tu na sjeveru vjerojatno dominirala istočnoeuropska grupa R1a/Eu19, koja se najviše pod antičkom dinastijom Arsakida iz njihove Parthije proširila kroz veći dio Perzije. U srednjem vijeku su uzastopne provale Huna, Mongola, Avara, Tatara, Seldjuka i inih mongoloidnih nomada postupno izmijenile genetski spektar na sjevernom rubu Irana i tu uvjetovale današnju dominaciju azijatskih haplogrupa. Jedino u prijestolnici Teheran je obilno zastupljen naš I/Eu7 sa 34%, ali to može dijelom biti i naknadna posljedica novije doselidbe iz raznih dijelova Irana, npr. iz Kurdistana. Sadanja sjeverna kurdska plemena (Dimili-Zazaki-Kizilbaši) koja isto imaju veliki udjel našega I/Eu7 do 33%, u srednjem vijeku su do 13. stoljeća živjela na južnom primorju Kaspijskog mora u pokrajini Dailâm i tada su čak kao posebni emirat zavladali većim dijelom Irana kao srednjovjeka etnogrupa Delamiti. S tim je bar dijelom povezan i visoki udjel od 34% našega I/Eu7 u susjednoj iranskoj prijestolnici Teheran, što dijelom može biti ranijega delamitskog iskona. Kasnije je ta kaspijska etnogrupa Delamita odbačena u istočnu Anatoliju pod nomadskim udarima Mongola i Seldjuka.

Moguće poredbe s Hrvatima

Ako se sadanji spektar Y-haplotipa kod Hrvata (34-72% I2/Eu7 + 23-34% R1a/Eu19 + 10-16% R1b/Eu18 + ini manji), usporedi s današnjim haplogrupnim spektrima na širjem ozemlju klasične Perzije, onda slijede iduće sličnosti i razlike:

  • Najviše se od nas genetski razlikuju južno primorje i sjeverni rub Irana, gdje dominiraju ine azijatske haplogrupe, dok naš specifični I/Eu7 tamo uglavnom posve izostaje, pa to genski nisu vjerojatna područja ranohrvatskog iskona ni selidbe.
  • Razmjerno su genetički manje vjerojatni kao naša stara obitavališta još sjeveroistok (Sogdija) i donekle središnji Iran.
  • Najvjerojatnija staroperzijska obitavališta koja su i danas najbliža genetici Hrvata jesu na zapadu Kurdistan i na istoku tzv. "Tribal Area" na sjeverozapadu Pakistana, gdje je vjerojatno bilo prvotno ishodište najranijih prapovjesnih nosilaca hrvatskog etnonima.

Takav genski raspored se približno poklapa s ranim navodima nama sličnih etnonima, pa se tako na zapadu u Kurdistanu spominje klasična etnogrupa Hurvuhé, pa prapovijesni Hurrwurtu i rani neolitski Hurrw-Urduv, a u istočnoj Harauvatiyi klasični Harauvati, prapovjesni Harahvaiti i u pradavnom halkolitu ranoarijska rigvedska praplemena Haraxvati i Haraquati: vidi o tomu još pobliže Indoiranski Prahrvati.

Bibliografija

  • Al-Zahery N. & al. (7 koautora) 2003: Y-Chromosome and mtDNA polymorphisms in Iraq, a crossroad of the early human dispersal and of post-Neolithic migrations. Mol. Phylog. & Evolution 28: 458-472.
  • Elisabetta Cilli, Paolo Delaini, Birgit Costazza, Laura Giacomello, Antonio Panaino & Giorgio Gruppioni 2010: Ethno-anthropological and genetic study of the Yaghnobis, an isolated community in Central Asia. Journal of Anthropological Sciences, 5 pp.
  • Cinnioglu C. & al. (13 koautora), 2004: Excavating Y-Chromosome haplotype strata in Anatolia. Human Genet. 114: 127-148.
  • Julie Di Cristofaro, Stephane Buhler, Shah Aga Temori, Jacques Chiaroni 2011: Genetic data of 15-STR loci in five populations of Afghanistan. Forensic Science International, Genetics (April 2011).
  • Harlette Lacau, Areej Bukharia, Tenzin Gaydena, Joel La Salvia, Maria Regueiroa, Oliver Stojkovic, Rene J. Herrera 2011: Y-STR profiling in two Afghanistan populations. Legal Medicine 13/2: 103-108, Japan. doi:10.1016/j.legalmed.2010.11.004
  • Mohyuddin A., Ayub Q., Qamar R., Zerjal T., Helgason A., Mehdi SQ., Tyler Smith C. 2001: Y-chromosomal STR haplotypes in Pakistani populations. Forensic Sci. Int. 118/2-3: 141-146.
  • Nasidze Ivan, Inasaridze G., Shengelia L.& al. 1990-1991: Genetics of the ethnic groups of Caucasus. Russian Journal of Genetics 26: 936-945, 1092-1101, 1300-1308, 1648-1659; 27: 1467-1474, 1626-1636, 1832-1839.
  • Nasidze Ivan 1995: Genetic polymorphism of populations of the Caucasus. Gene Geography 9: 91-167.
  • Nasidze Ivan, Schadlich H., Stoneking M. 2003: Haplotypes from the Caucasus, Turkey and Iran for nine Y-str loci. Forensic Sci. Int. 137: 85-93.
  • Nasidze Ivan & al. (17 koautora), 2004: Mitochondrial DNA and Y-Chromosome variation in the Caucasus. Ann. Human Genet. 68: 205-221.
  • Nasidze, Ivan & al. 2005: MtDNA and Y-Chromosome variation in Kurdish groups. Annals of Human Genetics, 69: 401-412.
  • Nasidze Ivan & al. 2006: Concomitant replacement of language and mtDNA in South Caspian populations of Iran. Current Biology 16: 668-673.
  • Nasidze Ivan, Quinque D, Rahmani M, Alemohamad SA, Stoneking M. 2008: Close genetic relationship between Semitic-speaking and Indo-European-speaking groups in Iran. Ann. Human Genet. 72/2: 241-252.
  • Nasidze I., Quinque D., Rahmani M., Ali Alemohamad S., Asadova P., Zhukova O., and Stoneking M. 2009: MtDNA and Y-chromosome Variation in the Talysh of Iran and Azerbaijan. Amer. Journal Phys. Anthr. 138: 82-89.
  • Passarino, Giuseppe & al. (11 koautora), 2001: The 49a.f haplotype 11 is a new marker of Eu19 lineage that traces migrations from northern regions of the Black Sea. Human Immunology 62: 922-932.
  • Qamar R., Ayub Q., Mohyuddin A., Helgason A., Mazhar K., Mansoor A., Zerjal T., Tyler-Smith C. and Mehdi S.Q. 2002: Y-Chromosomal DNA Variation in Pakistan. Am J. Human Genet. 70(5): 1107–1124.
  • Quintana-Murci L., Krausz C. et al. (13 koautora), 2001: Y-Chromosome lineages trace diffusion of people and languages in Southwestern Asia. Amer. J. Human Genet. 68: 537-542.
  • Rebala Kr., Mikulich A.I. & al. (7 koautora) 2007: Y-STR variation among Slavs, evidence for the Slavic homeland in the middle Dniepr basin. Journal Human Genet. Japan.
  • Regueiro M.& al. 2006: Iran; Tricontinental nexus for Y-Chromosome driven migration. Human Hered. 61: 132-143.
  • Roewer L., Willuweit S., Stoneking M., Nasidze I. 2009: A Y-STR database of Iranian and Azerbaijanian minority populations. Forensic Sci Int Genet. 4/1: 53-55.
  • Rootsi S. & al. (45 koautora), 2004: Phylogeography of Y-Chromosome haplogroup I reveals distinct domains of prehistoric gene flow in Europe. Amer. J. Human Genet. 75: 128-137.
  • Semino, Ornella & al. (21 koautor), 2000: The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans. Science 290: 1155-1159.
  • Weale M.E. & al. (8 koautora) 2001: Armenian Y-Chromosome haplotypes reveal strong regional structure within a single ethno-national group. Human. Genet. 109: 659-674
  • Wells R.S. & al. (27 koautora), 2001: The Eurasian hearthland, a continental perspective on Y-Chromosome diversity. PNAS 98/18: 10244-10249 (pnas.org.cgi).
  • Yunusbayev B.B., Kutuev I.A., Khusainova R.I., Guseinov G.G., Khusnutdinova E.K. 2006: Genetic structure of Dagestan populations (a study of 11 ALU-insertion polymorphisms). Human Biology 78/4: 465-476.
  • Žaksylyk Sabitov 2010: Etnogenez puštunov (Afgancev) s točki zrenya populacionnoj genetiki. Russian Journal of Genetic Genealogy 2/3: 60-63.

Poveznice

Reference

Condensed compilation from above literature and links, adapted and elaborated by GNU-license almost from WikiSlavia.